Page 1 of 1

Info-Mac Digest V12 #87

Posted: June 19th, 1994, 4:36 am
by Info-Mac
Subject: Info-Mac Digest V12 #87
Message-ID:
Date: 19 Jun 94 02:35:57 GMT
Sender: [email protected]
Reply-To: [email protected]
Organization: The Internet
Lines: 2543
Approved: [email protected]


Info-Mac Digest Sat, 18 Jun 94 Volume 12 : Issue 87

Today's Topics:

[*] Alpha 5.81 Text Editor
[*] Animaniacs icons
[*] Animaniacs sounds
[*] Application Feature Information AppleScript
[*] Ars Magna II 1.1.1 Fat version; an anagram generating program
[*] Auto-send files to an address (Eudora AppleScript)
[*] binpump201; identifies and sorts files
[*] chess-clock; the world's most expensive chess clock
[*] ChunkJoiner 1.1.1; concatenates files
[*] ClarisWorks 2.0CDv1-->2.1CD Updater for Canadian English versions
[*] ClarisWorks 2.0CFv1-->2.1CF Udater for Canadian French vesions
[*] ClarisWorks 2.0v1->2.1v4 Updater for US versions
[*] CoDec, a simple drop box application for Macintosh
[*] csmp-digest-v3-036
[*] Demo CDEF, example control definitions
[*] DeSEA 1.5; stips the SEA code from archives
[*] Disabling floppy drive (prog+source)
[*] Disinfectant 3.5; a virus detection and eradication utility
[*] doors-stack-30-hc; concerning the band The Doors
[*] dropstuff_public_beta; a compression utility
[*] eudora-send-file-auto-reply-as; an AppleScript for Eudora
[*] FileMaker Pro 2.1v2 Update fo Canbadian English versions
[*] First Things First Pro - review/report
[*] Fivestonesv2.3.2; a Go-Moku like board game
[*] Halma 1.1.1 (board game)
[*] Halma 1.1.1 (THINK C 7 source code)
[*] hermesii-CompuMatcher1.4d; Hermes II BBS External Application
[*] hyperExtras; a shareware Hypercard authoring utility
[*] IAN'S ICONS III; color icons
[*] JCONV-DD v.1.8E; a Kanji-code converter
[*] JCONV-DD v.1.8J; a Kanji-code converter
[*] linkage-interface-31; for analysis of genetic linkage data
[*] MacDraw Pro 1.5v3 (US) Update
[*] MIDIFile Converter; fiddles with creator attributes
[*] Recompile your THINK C libraries (script)
[*] rnMac 1.3b4, offline newsreader for UUPC/MacSlurp + ToadNews
[*] sitex3.5_public_beta; beta version of StuffIt Expander 3.5
[*] SNL-Misc.Sounds.Vol#1; a collection of 10 sounds
[*] Sword of Ages 2.1; a graphic text adventure
[*] the-news-235; a news reader
[*] Thermodynamics Courseware for First Year Students.
[*] The Vegetarian Game 0.1.1b3; an aeducational game
[*] TROJKA-10.HQX A falling blocks game
[*] UUCOPY beta; a UUPC copy utility
[*] VacationMail; a utility to set up vacation under UNIX
[Q] CE Toolbox weirdness.
Accessing files by mail?
against censorship
Apple Color StyleWrite Pro info.
Avec Scanner SCSI probs...
BBS/user groups
Beware DiskLock 3.0
Bridge games (A)
Can Someone Offer A Price For A Used Mac?
DoveFaxPro ARA file
Electromagnetic fields (EMF)
Email for Metrowerks
FileMaker Help
floating point co-processor
Follow up on Quadra 605 power supply
FTP-sites for graphics
Getting MacPPP to work with a Supra FAXModem 144LC
Help with Mosiac and Express Modem Tool
HP Thinkjet
Ink-jet printer: which one to buy? (Q)
Installer Pro 1.0 & Netdistributor 2.0
Japanese system Software (A)
Labels Control Panel (Q)
large scale backup solution
LaserWriter 8.1.2
LC III HD Help needed (2 msgs)
Mac applications on a Novell 3.11 server
Macintosh Application Environment (MAE)
Mac LC CMOS Battery Help
MacUser Magazine on-line letters (gulp)
Metrowers e-mail address [R]
MIDI on a Mac
Monitor Test Pattern Software (R)
Network fax server.
news readers
PowerMac Compilers (A)
PPC ugprade card and internal video cards
Printscreen from tn3270 2.4d9 to DeskWriter
ProDOS Extension Revisited
QuickDex: I need info (2 msgs)
Record Button extension (R)
Samna Word 4 files - converting to Mac
screen freezes
SCSI to 386/486 platform hard disk conversion (Q)
Sound Archives
Speed of PowerMac native Fortran compared to SGI and HP Unix
Syquest substitutes any good?
System 7.1 emergency dis
System 7.1 emergency disc [R]
TeachText/SimpleText Scrolling [Q]
US PowerMac pricing
Veronica and Al (2 msgs)
Why I would buy commercial Eudora
X-windows emulator

The Info-Mac newsgroup is moderated by Bill Lipa, Gordon Watts, Liam Breck
and Igor Livshits.

The Info-Mac archives are available (by using FTP, account anonymous,
any password) in the info-mac directory on sumex-aim.stanford.edu
[36.44.0.6]. Help files and indices are in /info-mac/help.

Mail articles for inclusion in the digest to [email protected].
Send binaries to be placed in the archives to [email protected].
Send administrative mail to [email protected].

----------------------------------------------------------------------

Date: Thu, 16 Jun 94 11:35:50 CDT
From: [email protected] (Pete Keleher)
Subject: [*] Alpha 5.81 Text Editor

This is version 5.81 of the text editor Alpha.

For those who are not familiar with Alpha, it is a completely programmable
and extendable text editor that has very extensive support for programming
in C and writing TeX or LaTeX documents.

5.81 automatically colorizes C, C++, Tcl, and TeX keywords and comments,
and can be configured to automatically colorize any other type of file as
well.

Other changes in 5.81 over the last public release, 5.77, include a much
improved external THINK editor support, rudimentary support for CodeWarrier
(their interface leaves much to be desired at this point), and an interface
to Jens Alfke's AEBuild library, which lets you create and send just about
any apple event you want from the macro language. Code currently exists to
interact with the THINK compilers, CodeWarrier, ToolServer, Textures,
OzTeX, THINK Reference, etc.

[Archived as /info-mac/text/alpha-581.hqx; 814K]

------------------------------

Date: Wed, 15 Jun 1994 12:33:02 -0500
From: Dan Pacheco
Subject: [*] Animaniacs icons

This is a package of nine Macintosh desktop icons from the hit Spielberg
series "Animaniacs." This file was compacted using Compact Pro and
binhexed afterward. To install an icon, simply click on the "folder"
that has the icon without opening it and "Get Info." In the Get Info, just
select the picture of the icon and "copy." You can do the same with
any other folder, except you select the folder and "paste." The icon is
automatically changed.

[Archived as /info-mac/gui/grf/dans-animaniacs-icons.hqx; 28K]

------------------------------

Date: Wed, 15 Jun 1994 12:32:54 -0500
From: Dan Pacheco
Subject: [*] Animaniacs sounds

Here are two System 7 Macintosh sounds from the hit Spielberg cartoon
"Animaniacs." The first sound is from "The Brain" saying, "Yes!"
The second is from Yacko, saying, "Look! It's big fat Scotty from Star
Trek!" The files are in one folder. After un-binhexing, decompress it
with Compact Pro.

[Archived as /info-mac/snd/dans-animaniacs.hqx; 52K]

------------------------------

Date: Thu, 16 Jun 1994 19:53:59 -0400
From: [email protected] (Mark Fleming)
Subject: [*] Application Feature Information AppleScript

Author:
By: R. Mark Fleming,
521 Albert street, Kingston, Ontario, Canada, K7K 4M5
Phone: (613) 545-2039 E-mail:

Description:
List file type and creator information about applications and files which
contain resources of: PowerPC code (cfrg), AppleScript Scripts (scpt),
AppleScript terminology resources (aete), Easy Open resources (open, kind)
when dropped onto this script application.

If the application contains Macintosh Easy Open resources (open, kind),
they are read and decoded to list readable file types and document type
descriptions.

Installing:
Place the Has Resource AppleScript Addition in the AppleScript Addition fold=
er
(it's located in the Extensions Folder). Drag "Application Feature
Information" on to your desktop (or some place on your hard drive) where it
is visible.

Using script to Collecting file information:
Drag & Drop the file(s) you wish to list on-to the AppleScript Dropplet
"Application Feature Information".

Requirements:
- AppleScript 1.0
- Scriptable Text Editor (for logging the output).
- System 7.0 or later
- Has Resource AppleScript Addition

History:
Version 1.0 first released.
Version 1.01 Added check for Scriptable Editor and Check if application is
a native PowerPC application
Version 1.1 Added looping code to list all resource of type 'kind', not
just the first one.

Note: You can read and change the script using the Apple Script Script Edito=
r.

Has Resource AppleScript Addition, (Shareware $15.00)

Description: Provides access to any type of resource of a file as a array
of characters.

[Archived as /info-mac/disk/application-feature-information-as.hqx; 48K]
[Archived as /info-mac/dev/resource-applescript-osax.hqx; 48K]

------------------------------

Date: Thu, 16 Jun 1994 13:37:35 -0700
From: [email protected] (Matthew Xavier Mora)
Subject: [*] Ars Magna II 1.1.1 Fat version; an anagram generating program

Here is an update of ArsMagna II 1.1.1. Metrowerks released a new version of
their ANSI lib with a much faster SIOUX implementation. This is just a
recompilation using the new Libs.

Enclosed is a Fat version of Ars Magna II. I ported it to Metrowerks
CodeWarrior
and resedited them together. Source and project file are included.

For those that don't know, Ars Magna is an anagram generating program
by Mike Morton. I've been updating it and releasing new versions
as I see fit. Someday it might have a real mac interface.

Matt

[Archived as /info-mac/text/ars-magna-ii-111.hqx; 202K]

------------------------------

Date: Wed, 15 Jun 1994 10:54:50 +0200
From: [email protected] (Philippe Casgrain)
Subject: [*] Auto-send files to an address (Eudora AppleScript)

Fellow Mac enthusiasts,

This is a little AppleScript that I wrote that will allow you to
auto-send one or more files to a pre-determined e-mail address (or
distribution list, if you have an Eudora nickname for it).

Simply duplicate the drag-on script, rename the copy to the
recipient's e-mail address or nickname and voila! Drag-and-drop auto-send
of as many files as you want!

Feel free to re-use this script in your own, and if you think they
are good enough, post them! (and send me a copy...)

Postcard-ware/E-mail-ware.

[Archived as /info-mac/comm/net/eudora-auto-send-to-address-as.hqx; 12K]

------------------------------

Date: Thu, 16 Jun 1994 15:01:27 -0700
From: Eric Shieh
Subject: [*] binpump201; identifies and sorts files

Binary Pump 2.01 performs two functions: 1) File Identification and 2) Filing.

File Identification sets the correct type and creator codes which are
normal to all Macintosh files. Files taken from the Internet or from
IBM PC type systems such as movies, sounds, or graphics usually will
not have the correct codes because they are from non-Macintosh
systems. Binary Pump thus, looks either at a) the files contents or b)
the fileUs file name extension to correctly setup the file for Macintosh
use. Binary Pump will also recognize and decode Macbinary files.

Filing is the organizational concept of placing certain files, in certain
folders. Binary Pump allows you to choose which files you would like
to move, duplicate, or alias to these folders through the use of file
attributes such as name, contents, date, type code, etcIBinary Pump
allows you to move files between different volumes (read the
manual before you do this though...).

All of Binary Pump's actions can be performed in the background.

The archive contains a comprehensive User's Guide in MS Word
format, containing an Index, Table of Contents, Pictures, and more.

Changes from version 2.00
-- now supports MacBinary II files (as opposed to plain Macbinary)
-- added Folder Filer
-- Fixed problem when aliasing to multiple folders
-- Fixed alias icons for folders
-- Removed remaining links in User's Guide
-- 'Other' key in preferences now works
-- Fixed bug in Set Name mouse clicking
-- Fixed various other minor glitches.

Binary pump is a Fat-Binary; it runs natively on both 68K and
PowerMac systems.

Shareware: $20

Eric
[email protected]

[Archived as /info-mac/cmp/binary-pump-201.hqx; 393K]

------------------------------

Date: Thu, 16 Jun 94 09:31:21 -0700
From: "Tantek I. Celik"
Subject: [*] chess-clock; the world's most expensive chess clock

Chess players use chess clocks to limit the amount of time which a game takes,
although I've seen chess clocks used to play other games also, like Scrabble.

ChessClock turns your Macintosh into the world's most expensive chess clock.
It handles multiple time controls, separate time for each player and has a very
nice large display for quick glancing during those heated speed chess games.
One player uses 'tab' as their clock button, and the other uses 'return'.

This binary may be included on the commercially available CD-ROM of the
archives.
ChessClock.hqx

Tantek Celik
[email protected]

[Archived as /info-mac/app/chess-clock.hqx; 9K]

------------------------------

Date: Thu, 16 Jun 1994 19:48:14 +0100
From: [email protected] (Fabrizio Oddone)
Subject: [*] ChunkJoiner 1.1.1; concatenates files

ChunkJoiner is a small utility that lets you join (concatenate)
any group of files in a single piece.
Select the files you want to join, and drag&drop them onto ChunkJoiner.

You can skip the data up to and including a configurable text string,
and/or skip the data beyond and including another configurable text string,
within each chunk going to be joined.
This is useful if you receive long e-messages and your e-mail gateway
splits the messages in several chunks.

ChunkJoiner works on any Macintosh, but it
**requires** System 7 or later.
Life is easier with a drag&drop interface.

New in 1.1.1:
Big bug fix.

Enjoy yourself and remember the $5 shareware fee!

Fabrizio Oddone
[email protected]

[Archived as /info-mac/disk/chunk-joiner-111.hqx; 35K]

------------------------------

Date: 16 Jun 1994 14:56:50 U
From: Anonymous.by.request
Subject: [*] ClarisWorks 2.0CDv1-->2.1CD Updater for Canadian English versions

There are two different updaters. The correct one to use depends on the
version of ClarisWorks you are currently using. If you have ClarisWorks
2.0CDv1, you should use the "CWks 2.0CDv1-->2.1CDv4" updater. If you have
ClarisWorks 2.1CDv1, 2.1CDv2, or 2.1CDv3 use the "CWks
2.1CDv1/v2/v3-->2.1CDv4" updater. To determine which version of ClarisWorks
you have, open any ClarisWorks document and choose "About ClarisWorks..."
>From the Apple menu (in the upper left hand corner of your screen).

This updater will not update Apple Power Macintosh versions of ClarisWorks
and is intended only for use with ClarisWorks for Macintosh 68K computers.

New Features
ClarisWorks 2.1 has many enhancements and new features, including support
for, PowerTalkx (electronic mail provided with System 7 Pro), automatic
hyphenation, Excel 4.0 import and export, and ClarisWorks 1.0 Word Processing
export.

System Requirements
If you are using System 6 you will need 2 Mb of RAM memory to perform the
update. If you are using System 7 you will need 3 Mb of RAM.

Hard Disk Space
You will need approximately 2 Mb of free disk space to install and use the
updater.

This file found to be virus-free with Disinfectant 3.5

[Archived as /info-mac/app/claris-works-20v1-to-21v4-updt-cd.hqx; 739K]
[Archived as /info-mac/app/claris-works-21vx-to-21v4-updt-cd.hqx; 137K]

------------------------------

Date: 16 Jun 1994 15:05:14 U
From: Anonymous.by.request
Subject: [*] ClarisWorks 2.0CFv1-->2.1CF Udater for Canadian French vesions

There are two different updaters. The correct one to use depends on the
version of ClarisWorks you are currently using. If you have ClarisWorks
2.0CFv1, you should use the "CWks 2.0CFv1-->2.1CFv4" updater. If you have
ClarisWorks 2.1CFv1, 2.1CFv2, or 2.1CFv3 use the "CWks
2.1CFv1/v2/v3-->2.1CFv4" updater. To determine which version of ClarisWorks
you have, open any ClarisWorks document and choose "About ClarisWorks..."
>From the Apple menu (in the upper left hand corner of your screen).

This updater will not update Apple Power Macintosh versions of ClarisWorks
and is intended only for use with ClarisWorks for Macintosh 68K computers.

New Features
ClarisWorks 2.1 has many enhancements and new features, including support
for, PowerTalk (electronic mail provided with System 7 Pro), automatic
hyphenation, Excel 4.0 import and export, and ClarisWorks 1.0 Word Processing
export.

System Requirements
If you are using System 6 you will need 2 Mb of RAM memory to perform the
update. If you are using System 7 you will need 3 Mb of RAM.

Hard Disk Space
You will need approximately 2 Mb of free disk space to install and use the
updater.

This file found to be virus-free with Disinfectant 3.5

[Archived as /info-mac/app/claris-works-20v1-to-21v4-updt-fr.hqx; 721K]
[Archived as /info-mac/app/claris-works-21vx-to-21v4-updt-fr.hqx; 136K]

------------------------------

Date: 16 Jun 1994 14:46:17 U
From: Anonymous.by.request
Subject: [*] ClarisWorks 2.0v1->2.1v4 Updater for US versions

There are two different updaters. The correct one to use depends on the
version of ClarisWorks you are currently using. If you have ClarisWorks 2.0,
you should use the "ClarisWorks 2.0v1-->2.1v4" updater. If you have
ClarisWorks 2.1v1, 2.1v2, or 2.1v3 use the "ClarisWorks 2.1v1/v2/v3-->2.1v4"
updater. To determine which version of ClarisWorks you have, open any
ClarisWorks document and choose "About ClarisWorks..." from the Apple menu
(in the upper left hand corner of your screen).

This updater will not update Apple Power Macintosh versions of ClarisWorks
and is intended only for use with ClarisWorks for Macintosh 68K computers.

New Features
ClarisWorks 2.1 has many enhancements and new features, including support
for, PowerTalkx (electronic mail provided with System 7 Pro), automatic
hyphenation, Excel 4.0 import and export, and ClarisWorks 1.0 Word Processing
export.

System Requirements
If you are using System 6 you will need 2 Mb of RAM memory to perform the
update. If you are using System 7 you will need 3 Mb of RAM.

Hard Disk Space
You will need approximately 2 Mb of free disk space to install and use the
updater.

This file found to be virus-free with Disinfectant 3.5

[Archived as /info-mac/app/claris-works-20v1-to-21v4-updt-us.hqx; 752K]
[Archived as /info-mac/app/claris-works-21vx-to-21v4-updt-us.hqx; 135K]

------------------------------

Date: Thu, 16 Jun 1994 00:28:32 -0500
From: [email protected] (Bretton Wade)
Subject: [*] CoDec, a simple drop box application for Macintosh

CoDec is a simple Drop Box Application for compressing and decompressing
files. I would like you to include it in the info-mac archive, please.
Distribution is free, and you are free to distribute it in any manner that
you see fit.

Bretton Wade ([email protected])
Program of Computer Graphics
580 Engineering and Theory Center
Cornell University
Ithaca, NY 14853
Voice: (607) 255-6704
Fax: (607) 255-0806

[Archived as /info-mac/cmp/co-dec.hqx; 45K]

------------------------------

Date: Thu, 16 Jun 1994 13:35:08 +0200 (MET DST)
From: [email protected] (Francois Pottier)
Subject: [*] csmp-digest-v3-036

C.S.M.P. Digest Thu, 16 Jun 94 Volume 3 : Issue 36

Today's Topics:

Apple Event example
Faster Square Root Algorithm
How to save alpha in PICT files?
Open Transport & ASLM
Sending the Mac Screen Image
What are Universal Headers?

The Comp.Sys.Mac.Programmer Digest is moderated by Francois Pottier
([email protected]).

[Archived as /info-mac/per/csmp/csmp-v3-036.txt; 142K]

------------------------------

Date: Thu, 16 Jun 1994 16:20:51 -0800
From: [email protected] (Jim Stout)
Subject: [*] Demo CDEF, example control definitions

[Archived as /info-mac/dev/jims-demo-cdefs.hqx; 49K]

------------------------------

Date: Thu, 16 Jun 1994 17:36:59 -0400 (EDT)
From: "Ken Hancock"
Subject: [*] DeSEA 1.5; stips the SEA code from archives

Enclosed is a StuffIt 3.0 archive containing DeSEA 1.5. DeSEA is a
System 7 savvy application which turns self-extracting archives
(SEA's) into their non-self-extracting counterparts. DeSEA supports
AppleEvents and System 7's drag 'n' drop from the Finder. Freeware.

DeSEA 1.5 adds support for NOW Compress and DiskDoubler 4.0 archives.
DeSEA 1.5 also fixes background-only operation when used in
conjunction with applications such as Fetch 2.1.2.

Enjoy!

Ken Hancock | INTERNET: [email protected] / AOL: KHancock
VideoGuide Inc. | CIS: INTERNET>: [email protected]

[Archived as /info-mac/cmp/desea-15.hqx; 31K]

------------------------------

Date: Wed, 15 Jun 1994 12:33:09 -0500
From: Todd Wilson
Subject: [*] Disabling floppy drive (prog+source)

This is a very simple hack that can disable the floppy drives on a Mac.
Not bullet proof by any means, but may have some applications outside of
my own system. Think C 7.0 project and source, along with
application/extension. StuffIt Deluxe archive.

[Archived as /info-mac/cfg/kill-drive.hqx; 8K]
[Archived as /info-mac/dev/src/kill-drive-c.hqx; 8K]

------------------------------

Date: Wed, 15 Jun 1994 13:49:41 -0500
From: [email protected] (Igor Livshits)
Subject: [*] Disinfectant 3.5; a virus detection and eradication utility

Howdy,

Apparently, the original had the invisible bit set. This is merely a repost
to fix that problem. Not all systems were affected, but the problem
definitely appears under A/UX 3.1.

Cheers, Igor

[Archived as /info-mac/vir/disinfectant-35.hqx; 210K]

------------------------------

Date: Wed, 15 Jun 1994 16:28:32 -0500
From: [email protected] (Brian Davies)
Subject: [*] doors-stack-30-hc; concerning the band The Doors

This is the June 1994 release of The Doors Stack, a HyperCard
compendium of artwork, poetry, trivia and information relating
to the musical group The Doors. This version, 3.0, includes
much-improved full-screen graphics for the album covers, more
notes on the songs, and minor corrections. Send comments and
corrections to [email protected].

- Brian

[Archived as /info-mac/info/nms/doors-stack-30-hc.hqx; 182K]

------------------------------

Date: Thu, 16 Jun 1994 14:24:51 -0700
From: Aladdin Systems
Subject: [*] dropstuff_public_beta; a compression utility

This installs DropStuff with Expander Enhancer 3.5, a new, shareware product
>From Aladdin Systems with major benefits: Easy Stuffing from the Finder. Power
Mac users get "accelerated" expansion and stuffing. W/ StuffIt Expander you
can expand .zip, .arc, .pkg, .gz, .Z, .uu, and SpaceSaver files. It can join
StuffIt segments, and much more! This file is provided AS IS! Disinfectant 3.5
shows no viruses in this file.
DropStuff_PublicBeta_Installer.hqx

[Archived as /info-mac/cmp/drop-stuff-with-enhancer-35b.hqx; 507K]

------------------------------

Date: Thu, 16 Jun 1994 22:58:00 +0200
From: [email protected] (Philippe Casgrain)
Subject: [*] eudora-send-file-auto-reply-as; an AppleScript for Eudora

This script uses AppleScript lists and Eudora to auto-reply to mail
messages. It is very useful when a whole lot of people ask you for the same
file over and over again, such as when you posted a distribution offer on
USENET.
Running the script for the first time will allow you to select the
file(s) and subject(s) to match, which will be remembered thereafter.
The only way to make the script "forget" theses properties is to
re-compile it (with the script editor), so it is advised to always work
with a copy of the "virgin" script.

Postcard-ware. Check it out! It's less than 15K!

[Archived as /info-mac/comm/net/eudora-send-file-auto-reply-as.hqx; 15K]

------------------------------

Date: 16 Jun 1994 15:23:47 U
From: Anonymous.by.request
Subject: [*] FileMaker Pro 2.1v2 Update fo Canbadian English versions

This update package consists of two components: an application updater for
the FileMaker Pro application, and secondly, the updated MacIPXx files if you
are using MacIPXx for your FileMaker Pro networking. The FileMaker Pro
application updater is in the folder named FileMaker Pro 2.1CDv2 Updater. The
MacIPXx files are in a folder named MacIPXx Updater.

NOTE: Novell's MacIPXx software is only necessary if you are on a Novell
NetWare network and are sharing FileMaker Pro databases between computers
running Windows and Macintoshes.

Hard Disk Space
You'll need enough room for both the original application and the new version
(approximately 2MB of disk space for both).

This file found to be virus-free with Disinfectant 3.5

[Archived as /info-mac/app/fmpro-21v2-updt-ca.hqx; 258K]

------------------------------

Date: Wed, 15 Jun 1994 16:20:39 -0500 (EST)
From: Mark Nutter
Subject: [*] First Things First Pro - review/report

Below is my review of the calendar/reminder/project-management utility
First Things First Proactive, by Visionary Software.

Mark Nutter
[email protected]

[Archived as /info-mac/info/sft/first-things-first-review.txt; 9K]

------------------------------

Date: Wed, 15 Jun 1994 05:28:46 -0400
From: Xin Xu
Subject: [*] Fivestonesv2.3.2; a Go-Moku like board game

This version (2.3.2) fixed two bugs. One is the "unimplement trap" error
on 68000 machines (Mac Plus & SE). The other is larger-that-screen board
on small screen (9") when default board size has been set on a Mac with
larger Mac.
A $10 shareware.

Xin Xu

[Archived as /info-mac/game/brd/five-stones-232.hqx; 63K]

------------------------------

Date: Tue, 14 Jun 1994 16:18:50 -0400 (EDT)
From: [email protected] (Mark Pilgrim)
Subject: [*] Halma 1.1.1 (board game)

Halma 1.1 is a solitare board game in which you must move nine tiles from one
corner of the board to the other in the minimum number of moves. 21 unique
boards in all. This version fixes several technical bugs and adds
cross-reference buttons to the help section. C source code also available;
check ftp sites or e-mail [email protected]. Finger [email protected] for
complete program list. Copyright (C) 1994, Mark Pilgrim. Please read
enclosed file "GNU General Public License" for licensing details. 640K
memory, 141K disk, B/W or color monitors, system 4.1 or later. Sounds
require system 6.0.7 or later.

[Archived as /info-mac/game/brd/halma-111.hqx; 119K]

------------------------------

Date: Tue, 14 Jun 1994 16:19:41 -0400 (EDT)
From: [email protected] (Mark Pilgrim)
Subject: [*] Halma 1.1.1 (THINK C 7 source code)

Halma 1.1.1 is a solitare board game in which you must move nine tiles from
one corner of the board to the other in the minimum number of moves. 21
unique boards in all. This version fixes several technical bugs and adds
cross-reference buttons to the help section. This archive contains the
complete THINK C 7 project and resource files. Application also available;
check ftp sites or e-mail [email protected]. Finger [email protected] for
complete program list. Copyright (C) 1994, Mark Pilgrim. Please read
enclosed file "GNU General Public License" for licensing details.

[Archived as /info-mac/dev/src/halma-111-c.hqx; 253K]

------------------------------

Date: Wed, 15 Jun 1994 12:32:42 -0500
From: "Scott E. King"
Subject: [*] hermesii-CompuMatcher1.4d; Hermes II BBS External Application

CompuMatcher Plus is an external program for use with Hermes II BBS.
This external is a matching program for users. Sysops can create up
to 6 different questionnaires for users to answer and score with other users.
Demo version. Register for full version. NOT for commercial distribution.

[email protected]

[Archived as /info-mac/comm/hermes-ii-compu-matcher-14d.hqx; 171K]

------------------------------

Date: Wed, 15 Jun 94 15:00:45 BST
From: David Donachie
Subject: [*] hyperExtras; a shareware Hypercard authoring utility

This is a cpt archive of HyperExtras, a shareware Hypercard authoring
utility in HC 2.1 format. It contains many scripts and utilities which
are fully described in the stack and in the acomponying documentation.

[Archived as /info-mac/card/hyper-extras-hc.hqx; 133K]

------------------------------

Date: Thu, 16 Jun 1994 17:59:31 -0500
From: Michael Noah Gurell
Subject: [*] IAN'S ICONS III; color icons

Thanks for taking the time to download Ian's Icons III. They took me hours
to design, and if I am to continue providing quality icons, loyal
supporters must continue to send in their shareware fees. If you like the
icons, and use them, please send a single dollar shareware fee to:

Ian Ference
30 South Gate
Fairport NY 14450.

Enjoy the icons!

P.S. The icons are in the phoney Teach-Text document entitled Read Me. I
did this because I know from experience that no one will read this if I
don't.

[Archived as /info-mac/gui/grf/ians-icons-grp3.hqx; 57K]

------------------------------

Date: Thu, 16 Jun 1994 14:47:02 -0400 (EDT)
From: Natsu Sakimura
Subject: [*] JCONV-DD v.1.8E; a Kanji-code converter

This is JCONV-DD v.1.8E (English Version).

JCONV-DD is a Kanji-code converter. It

1) Auto-detects the Kanji Codes of an input file
2) Drag & Drop interface
3) Converts end-of-line characters
4) Can set preference for each input file type so that once
you set it, you will not be required to interact with it
any more.
and much more.

Version 1.8 automated the fixing and conversion of damaged
JIS file. It has much better interface to treat ASCII files
as well.

JCONV-DD is a DonateWare.

Enjoy,

Natsu Sakimura

[Archived as /info-mac/text/jconv-dd-18.hqx; 48K]

------------------------------

Date: Thu, 16 Jun 1994 14:46:18 -0400 (EDT)
From: Natsu Sakimura
Subject: [*] JCONV-DD v.1.8J; a Kanji-code converter

This is JCONV-DD v.1.8 (Japanese Version).

JCONV-DD is a Kanji-code converter. It

1) Auto-detects the Kanji Codes of an input file
2) Drag & Drop interface
3) Converts end-of-line characters
4) Can set preference for each input file type so that once
you set it, you will not be required to interact with it
any more.
and much more.

Version 1.8 automated the fixing and conversion of damaged
JIS file. It has much better interface to treat ASCII files
as well.

JCONV-DD is a DonateWare.

Enjoy,

Natsu Sakimura

[Archived as /info-mac/text/jconv-dd-18-jp.hqx; 52K]

------------------------------

Date: Wed, 15 Jun 1994 13:04:10 -0500
From: "B. Nichols"
Subject: [*] linkage-interface-31; for analysis of genetic linkage data

Enclosed is a copy of Linkage Interface version 3.1, a program for
organization and analysis of genetic linkage data. I would appreciate it
if you would put it in a molecular biology or genetics file directory.
Please distribute wherever you see fit. Direct any questions to
[email protected]. For your archive, the description of the
file is as follows:

Linkage Interface is a program for the organization and analysis of genetic
linkage data. Described in CABIOS 9: 757-9 (1993), Linkage Interface acts
as an interface between raw polymorphic marker data and the genetic linkage
programs (i.e. LINKAGE). This program is a useful way to archive large
amounts of polymorphic marker data. In addition, it can analyze linkage
data for correct inheritance patterns and can also assist in both allele
reduction and haplotype analysis. Linkage Interface is a stand-alone
application created using Hypercard 2.2.

[Archived as /info-mac/sci/linkage-interface-31.hqx; 930K]

------------------------------

Date: 16 Jun 1994 15:12:02 U
From: Anonymous.by.request
Subject: [*] MacDraw Pro 1.5v3 (US) Update

This version of MacDraw Pro fixes a problem with placing library objects
while running on a Power Macintosh in emulation mode.

MacDraw Pro 1.5v2 Release notes (for those updating from 1.5v1)

A PICT import bug was fixed. Under certain circumstances, open polygons were
closed when they were imported.

A PICT export bug was fixed. Under certain circumstances, a rounding error
would cause objects to be clipped when opened in other applications.

A text entry bug was fixed. Text was lost when entering text by clicking in
the document and changing Font and Size attributes through their associated
dialogs.

A Gridline display bug was fixed. When running System 6.0.x with millions of
colors, MacDraw Pro 1.5 displayed solid gridlines when the Screen buffer was
turned off.

An Open Application (oapp) Apple event bug was fixed. A system crash occurred
when sending an oapp event when MacDraw Pro 1.5 was already open and in the
background.

The "Command-Option-Space" key sequence used to hide and show the Tool and
Style bars, has been extended to include "Command-Option-Tab". This key
sequence was added for use with system 7.1. Note that either
"Command-Option-Space" or "Command-Option-Tab" will work when running systems
6.0.x or 7.0.x.

This file found to be virus free with Disinfectant 3.5

[Archived as /info-mac/app/mac-draw-pro-15v3-updt.hqx; 484K]

------------------------------

Date: Thu, 16 Jun 1994 16:04:47 --100
From: [email protected] (Axel Luedecke - Sun Germany Tech Support -
Munich)
Subject: [*] MIDIFile Converter; fiddles with creator attributes

MIDIFile Converter is a small utility that is compatible with
System 6.x and System 7.x that helps you use MIDIFiles on your
Macintosh. Here is the scenario:

1) You download a MIDFile from
2) You uncompress the file
3) You double click the MIDIFile
4) You are confronted with the 'Application not found' Dialog Box!!!
5) or want to import the MIDFile from a sequencer and the file does
not show up in the 'Open' Dialog Box.

Using MIDIFile Converter you can change the CREATOR information of the
MIDIFile so that it:
1) Takes on the proper icon of the application you are using for
sequencing.
2) Open the proper application when double-clicked

MIDIFile Converter will also be invaluable if you download MIDIFiles from
services that support other platforms (IBM, Atari, etc). Many times when
obtain MIDIFiles from these platforms they are totally unreconizable by
most sequencer packages as being MIDIFiles.
MIDFIle Converter can change all that.

(the above is from the README file, created by Joe Zobkiw)
All credits to the program belong to Joe Zobkiw!

Axel Luedecke +49 (089) 46008-518
Sen. Systems Engineer
SMCC, Sun Microsystems GmbH [email protected]

[Archived as /info-mac/disk/midi-file-converter.hqx; 15K]

------------------------------

Date: Thu, 16 Jun 1994 17:31:56 +0200
From: [email protected] (Philippe Casgrain)
Subject: [*] Recompile your THINK C libraries (script)

This is a little script by Jamie McCarthy
that I improved upon. It allows you to perform the "Library conversion"
step (step 5) of the THINK C 6.0.1 -> 7.0 update using AppleScript.
(I have Jaimie's permission to re-distribute this modified copy :-)

Quite useful when upgrading, if you have AppleScript (any version).

[Archived as /info-mac/dev/think-601-to-70-library-conversion-as.hqx; 15K]

------------------------------

Date: Wed, 15 Jun 1994 11:05:17 -0400 (EDT)
From: [email protected] (Roy Wood)
Subject: [*] rnMac 1.3b4, offline newsreader for UUPC/MacSlurp + ToadNews

Here's version 1.3b4 of rnMac, an offline newsreader for use with ToadNews
and one of UUPC or MacSlurp.

This version fixes a bunch of little bugs that caused a lot of grief
in the previous release.

Still plugging away on things.....

-Roy

[Archived as /info-mac/comm/rn-mac-13b4.hqx; 218K]

------------------------------

Date: Thu, 16 Jun 1994 14:12:16 -0700
From: Aladdin Systems
Subject: [*] sitex3.5_public_beta; beta version of StuffIt Expander 3.5

Public Beta *** Provided AS IS *** Expires 16-August-94

This installs StuffIt Expander 3.5, a major update of this award-winning
freeware product. It is designed to be the simplest, most efficient way to
expand StuffIt, Compact Pro, BinHex and MacBinary files. And if you add our
new "DropStuff w/ Expander Enhancer" you get PowerMac acceleration, expansion
of many other formats, and much more! This file is provided AS IS!
Disinfectant 3.5 shows no viruses in this file.

[Archived as /info-mac/cmp/stuffit-expander-35b.hqx; 241K]

------------------------------

Date: Thu, 16 Jun 1994 17:59:42 -0500
From: Michael Noah Gurell
Subject: [*] SNL-Misc.Sounds.Vol#1; a collection of 10 sounds

This is a collection of 10 Sounds taken from Saturday Night Live. These
are a few of my favorite ones so I stuck them in the First Volume. I will
be hopefully be sending up a Volume of new SNL sounds every so often. The
following Sounds are included in this Archive:

1. Crazy Tea Bag Mouth - Adam Sandler on Halloween SNL Show '93. "I'm Crazy
Tea Bag Mouth
and I do believe I want some Candy."
2. Fork It Over - From Same Skit with Adam Sandler. "Give me some Candy...
Fork it over!"
3. For the Love of God - From the Harley Boy GrandmaSitters Sketch Chris
Farley saying, "For the
love of god!"
4.Let him give her a Bath - Same Harley Grandmasitters sketch Chris Farley
saying," Sweet
jumping mary and joseph.. Let the Boy give her a Bath!"
5.Let the Boy marry your grandma!- Same Harley sketch - Farley saying, "
Let the boy marry
your grandma. Age difference Smage Difference."
6.Off Campus Kegger - From a Game Show sketch. Phil Hartman saying,"Off
Campus Kegger!"
7.SNL My Weiner - From the Girlfriend Sketch with Adam Sandler. He calls a
1-900 #. "Where do
you want me to touch you. My WEINER!"
8.Wicked Huge Copper Rod - Adam Sandler Saying, "A Wicked huge Copper rod
went right through
my arm pit." (In a Bostonian accent)
9. Wicked Pisser - Adam Sandler saying, "Wicked Pisser!"
10. Ya Put your Weed in there - From the weed Shop Sketch. "Ya put your
weed in there!"

These sounds were all recorded using the Stock Mic that came with my LCII.
They are all of pretty good quality. I have about 100+ more SNL sounds
>From last season including many Motivational Speaker sounds. Send me mail
at [email protected] for requests or just to say
Hi!

[Archived as /info-mac/snd/michaels-snl-sounds-grp1.hqx; 900K]

------------------------------

Date: Thu, 16 Jun 1994 18:00:11 -0500
From: Michael Noah Gurell
Subject: [*] Sword of Ages 2.1; a graphic text adventure

Sword of Ages is a graphic text adventure where the stress is on puzzle
solving although there is plenty of hack and slash. This is my first
shareware product so be sure to send in the shareware fee. The game is
quite simple to play, but I hope it takes a little bit longer to win than
to learn.

1994 by Philip Bonham. You may distribute them freely however you must
include the this file and the sound library with the program. If after 30
days you have not registered your copy I would ask you to delete "Sword of
Ages 2.1" from your software library. You may NOT alter the program "S
word of Ages 2.1", this file, or the included sound library in any way. You
may NOT sell the program "Sword of Ages 2.1". This includes any
"distribution fees" however you may feel free to upload it to a computer
Bulletin Board System or Online Service. Also, computer user groups and
other NON-PROFIT organizations may include it in their software collection
as long as it is freely distributed or an EXTREMELY modest distribution fee
is charged. If any FOR-PROFIT organizations would like to include this
program they should contact me and we MIGHT be able to reach a deal.
If you have comments, suggestions, or are sending in the registration fee
use the following address.

Philip Bonham
145 Laburnum Crescent
Rochester, New York 14620

You can also reach me on America Online as PhilipLRB or on the internet as
[email protected].
LEGAL STUFF
In no event will the author be liable to you for any special,
consequential, indirect, direct, or similar damages, including any lost
profits or lost data arising out of the use or inability to use Sword of
Ages 2.0 or any data supplied therewith even if t
he author or anyone else has been advised of the possibility of such
damages, or for any claim by any other party.

[Archived as /info-mac/game/sword-of-ages-21.hqx; 655K]

------------------------------

Date: Thu, 16 Jun 1994 00:13:21 -0400 (EDT)
From: [email protected] (William D Cramer)
Subject: [*] the-news-235; a news reader

This is a bug fix release to TheNews. Please refer to the
"Readme" and "Version 2.35 Changes" files for details.

Bill Cramer
504 Winterwood Drive
Grapevine, TX 76051 USA
[email protected]

[Archived as /info-mac/comm/the-news-235.hqx; 323K]

------------------------------

Date: Thu, 16 Jun 1994 15:44:41 -0300
From: [email protected] (Cameron Bales .:.)
Subject: [*] Thermodynamics Courseware for First Year Students.

This stack is part of a series which has been created at Mount Allison
University as a part of the T=E9l=E9Education NB TeleEducation=81 distance
education program. This stack is the property of Mount Allison University,
=A9 1994. Students, staff and faculty of Mount Allison are free to make use
of any portions of the stack for any personal, noncommercial purpose
(without seeking specific permission). Other users should seek permission
>From the authors at the address given below. Unauthorized distribution is
not permitted.

This specific stack on Thermodynamics is being put to a more general
release so that I can get some more input on what I should be doing, and
see if anyone can learn anything from it. Please if you download send me a
note saying what you think about what is good, what is bad, what ought to
be done, what I overdo...

[Archived as /info-mac/sci/thermodynamics-first-course-hc.hqx; 672K]

------------------------------

Date: Thu, 16 Jun 1994 10:52:45 +0000
From: [email protected] (Paul Russell)
Subject: [*] The Vegetarian Game 0.1.1b3; an aeducational game

This is a simple educational game produced by the Vegetarian
Resource Group. It's a multiple choice quiz covering various
areas of interest related to vegetarianism, veganism, animal
rights and nutrition.

I am responsible for porting this from DOS to Mac. Everything
else is the responsibility of the Vegetarian Resource Group.

This program may be freely distributed but should not be
modified or sold for commercial profit.

Please note that the 'READ ME' text file is not entirely accurate
in its instructions on how to play the game - hopefully this will
be rectified in a future version. It should be fairly obvious
to any Mac user how the game works but if you have any queries
please feel free to e-mail me.

//Paul

[Archived as /info-mac/game/vegetarian-game-011b3.hqx; 71K]

------------------------------

Date: Wed, 15 Jun 1994 09:52:57 --100
From: [email protected] (Maarten Los)
Subject: [*] TROJKA-10.HQX A falling blocks game

Dear Maccers,

I submit a copy of a game I recently wrote. It's called "Trojka" and it
packs the thrill of Tetris and the combinations of Columns into one
attractive game. The sounds are cool, too.

It was tested on Classic and on a Performa 400 and works in both color
and black & white. Trojka needs at least 500k of memory and preferably
system 7 or later to run. The program comsumes about 400k on your disk.

More documentation is included in the package.

Moderators: you may include this humble program on some CD-ROM if you
like.

Greetings,
Maarten Los & E4-Software
[email protected]

[Archived as /info-mac/game/arc/trojka.hqx; 429K]

------------------------------

Date: Thu, 16 Jun 94 12:19 EDT
From: larryp%[email protected] (Larry Pearlstein)
Subject: [*] UUCOPY beta; a UUPC copy utility

Attached is a beta (alpha really) version of my program UUCOPY. It is
hopefully a fat binary - that is - it should run natively on both Power
Macs and classical Macs. I HAVE ONLY TESTED THIS SOFTWARE ON A POWER MAC!
Yes, I recognize that this program will rarely benefit by the Power Mac's
muscle, but I feel like it's a good thing to get into the habit of
producing PM native code.

UUCOPY is intended to allow the user to select files for transfer via the
Mac version of UUPC.

The first time UUCOPY is run the user is prompted to locate the UUPC
settings file. This file path is stored in a Preferences file in the
System folder.

The user can choose any or all of the systems defined in the UUPC ROUTEVIA
field as destinations through a dialog box. The selected destinations are
saved in the Preferences file on exit for convenience.

NOTE WELL that UUCOPY only copies data forks -- it is currently your
responsibility to make sure that the information that you want to transfer
is all in the data fork. For normal Mac files you may want to use BinHex
or MacBinary formats.

If there is sufficient interest, I'll integrate MacBinary conversion into
UUCOPY.

UUCOPY requires System 7.

Please send bug reports and comments to:

Larry Pearlstein
larryp%[email protected]

Best wishes,
Larry

[Archived as /info-mac/comm/uu-copy-beta.hqx; 102K]

------------------------------

Date: Wed, 15 Jun 1994 14:50:09 -0700
From: [email protected] (MR Mac Software)
Subject: [*] VacationMail; a utility to set up vacation under UNIX

VACATIONMAIL 1.0

VacationMail is a utility for UNIX based e-mail users (such as
Eudora, TCP Connect, ZMail, etc.) that quickly and easily configures
a vacation feature to reply to all incoming e-mail messages while
users are unavailable.

Users setup their mail account information and then create the
vacation message they wish to have sent out. VacationMail is
"Eudora-aware". So users of the popular public domain and commercial
mail program will be able to configure VacationMail with two simple
clicks - skipping the account setup step. The auto response system in
vacation will only send one message per week to any one e-mail address
and will not respond to messages from mailing lists or list servers.
A full Unix based mail account is necessary for VacationMail to run
properly.

VacationMail is an *essential* tool for users who rely on e-mail as a
critical part of their job. It will keep users informed of periods of
unavailability with the user configurable subject and e-mail body. To
examine this demo simply double click and follow along with the context
sensitive help system provided. For additional information, you may check
the balloon help menu. (The menu of choices listed under the balloon help
icon.) The "Commonly Asked Questions" menu might be of special interest
to users with questions about the program.

If you have any additional questions not answered in the balloon help menu,
please send a message to [email protected] and we'll do our best to provide
you with an answer.

Thank you for your interest in VacationMail!

[Archived as /info-mac/comm/net/vacation-mail-10.hqx; 51K]

------------------------------

Date: 17 Jun 1994 14:17:05 -0400
From: [email protected] (kriens,john)
Subject: [Q] CE Toolbox weirdness.

I recently downloaded the latest version of CE Toolbox from the archives.
Now, unfortunately, whenever I open certain applications from OnCue II (such as
Mosaic or Excel), I automatically have a QuickMail window opened for me in
addition to the application that I *wanted* to open. This is getting very
annoying. How do I stop it?

Any help is greatly appreciated. Thanks in advance.

-John Kriens
[email protected]

------------------------------

Date: Fri, 17 Jun 1994 13:09:03 -0500
From: [email protected] (Michael E. Gaines)
Subject: Accessing files by mail?

Howdy,
Our company is in the unfortunate position of not having Internet
access for another six months or so. Until that time, I was wondering if
there is a way to request files my an automated mail server. I thought I
saw one at another company in the same predicament about a year ago. If so,
I'd like to know how as well as info on getting the digest sent here to my
account for distribution. Thanx!

Mike Gaines
Macintosh Development Group

============================Mike Gaines=================================
= WHAT is your name? Captain Jean-Luc Picard =
= WHAT is your quest? I seek the Holy Grail =
= WHAT is the top velocity of a Bird of Prey? Romulan or Klingon? =
= I....I don't know...AAAHHHH!!!! =
[email protected]==========================
THX Approved

------------------------------

Date: Fri, 17 Jun 1994 10:35:31 -0700
From: [email protected]
Subject: against censorship

Robert Morelos-Zaragoza writes:
>Someone posted a complaint in the usenet about the title of my previous
>submission "malaysian-mouse-crashes.txt" and suggested that any reference
>to "Malaysia" be removed from the text. I must oblige and enclosed is a
>revised version
>
Are censorship and political correctness invading the network?

I have followed the mouse-problem story, and the reports indicate that only
certain models made in Malaysia are causing trouble. If this is true, then
the identification of the country of origin is appropriate. If mice from
other some countries also cause trouble, then the names of those countries
should be added to the list. Supression of information about the country
of origin of the troublesome mice is not appropriate.

Down with censorship!

------------------------------

Date: Thu, 16 Jun 94 11:32:14 -0400
From: [email protected] (Marsha Allen)
Subject: Apple Color StyleWrite Pro info.

Greetings,

Thanks to the people who responded to my request for information on the
Apple Color StyleWriter Pro.
[email protected] (Ephraim Fithian)
[email protected] (Conrad Weiler)
[email protected] (Wayne Brissette)
[email protected] (Charles A. Patrick)

The responses are a little thin, probably because it's such a new
product. I also asked a acquaintance (a Mac consultant), but he didn't
know anything, his business tends toward higher end equipment use.
Anyway, the consensus seems to be that the Color StyleWrite is a good
printer for the price. The quality of both the color and monochrome
printing is very good and it prints on both paper and transparencies.
However, it works best on paper and transparency stock which is specifically
designed for inkjet printers. It is expensive stuff (transparencies are
about $1 a sheet) , but I've seen it listed in the Inmac catalog,
so it's not hard to find.

The only problem mentioned was some difficulty in getting the printer
sharing facility to work over EtherTalk. Charles Patrick posted a
previous message about his problems with that aspect.

The result of all this is that we have decided to buy one of these
little guys. I'll post more information after we receive it and start
playing around.

Marsha Allen [email protected]

------------------------------

Date: Fri, 17 Jun 94 04:00:12 EDT
From: Allan Hunter
Subject: Avec Scanner SCSI probs...

My girlfriend just recently bought an Avec color scanner along with
limited-edition Photoshop (which is the only medium provided into which
to receive the scans).

It's a SCSI device with nonstandard port design: a single SCSI port,
internal jumpers (yuck!) to set the SCSI ID, no apparent switch or
resistor or button to set termination. Obviously, the Avec wants to be
the last thingie on the SCSI chain (obnoxious); less obvious is how to
terminate it--we've tried attaching the incoming cable to a double-sided
terminator, then attaching that to the scanner's one SCSI port, and we've
tried attaching the cable without using the terminator. As long as the
other devices remain on the chain, the Mac and the Avec go into mutual
vaporlock when one hits the Scan button on the scanner plug-in inter-
face (the Avec sits with its green light on but not moving; the Mac
displays a wristwatch that can be moved via mouse, but its hands are
frozen and the Mac is otherwise unresponsive until restart).

Behavior continues with all extensions off except those directly needed
for the scanner; with and without virtual memory; with and without all
available memory assigned to Photoshop via the Get Info dialog box.
Configuration: a Q 605 with 4 MB RAM.

We actually DID ever get it to work--by removing the external hard drive
and the CD-ROM drive from the SCSI chain, so that the Avec has SCSI all
to itself (except for the internal HD and the CPU). I think that, at the
time, it was unterminated. But this is not a reasonable arrangement; she
isn't going to want to disconnect everything else every time she wants to
scan something.

Any suggestions? Similar experiences? Commiserations?

-Allan Hunter



------------------------------

Date: Wed, 15 Jun 1994 21:52:22 -0700 (PDT)
From: Jonathan Ziegler
Subject: BBS/user groups

I recieved this addres from the computer desk at the Univ. of Washington.
Tehy said that you are an online Mac user group. If so, please contact me
or direct me in the right direction.

thanks
Jonathan Ziegler

------------------------------

Date: Thu, 16 Jun 1994 17:51:27 EST
From: [email protected]
Subject: Beware DiskLock 3.0

Symantec has started shipping the newly rechristened Norton DiskLock 3.0. A
co-worker received it yesterday, installed on her Mac IIci, and restarted.
Chimes of Death and Sac Mac. Even when trying to start with a floppy.

Symantec tech support (after a long time on hold and being passed from
department to department) talked her through unplugging the ribbon cable on
the internal drive, starting off a floppy, plugging the cable back in, and
running Emergency Unlock. EU reported successful removal of DiskLock.

Restart - Chimes of Death and Sac Mac. Diagnosis - hard disk driver trashed.
Tech support admitted that disk driver may need to be updated prior to
installation (not
in manual anywhere). They gave up and offered refund. Thanks a lot, guys.

(Happy ending: we were able to use Hard Disk Toolkit to put a new driver on the
disk - let's hope FWB never sells out to Symantec.)

Mitch


-BMUG Boston 617-721-5840, East Coast BBS of The World's Largest Mac User Group

------------------------------

Date: Fri, 17 Jun 94 14:18:22 -0500
From: "Joshua B. Colglazier"
Subject: Bridge games (A)

Dear Bruno,

MicroBridge Companion is currently sold by:

Great Game Products
8804 Chalon Drive
Bethesda MD 20817
301/365-3297

I called them and they said that they do ship to Italy.

Good Luck!

--------------------------------------------------------------------
Joshua Colglazier Future Educator
Life is too short to waste on things that don't matter, help make the
world a better place through kindness to those around you.
Direct replies/comments/questions to [email protected]
--------------------------------------------------------------------

------------------------------

Date: Fri, 17 Jun 94 08:02:00 -0600
From: WANDERER_DAVID/[email protected]
Subject: Can Someone Offer A Price For A Used Mac?

Greetings,

I recall seeing a list of used macs and their street prices...can
anyone tell me where to find this information or even better, can
you offer a suggestion for the following configuration:


MAC IIci 80 meg hard drive
12meg RAM
Personal Laserwriter LS
Syquest 44 Drive
5 Sygquest Cartridges (44meg each)
Denon CD-ROM (I think it is single speed)
13" RGB Color Monitor


I used to use this setup at home for work. However, my job...ugh...is
demanding a PC more and more...I never thought this day would come but
it finally did.


Any suggestions would be greatly appreciated.

Regards

Dave Wanderer

------------------------------

Date: Fri, 17 Jun 94 12:12:37 JST
From: [email protected] (Paul Fons)
Subject: DoveFaxPro ARA file

Hoping someone can help. We have someone here who purchased two DovefaxPro
modems last year (14.4KBaud) and needs the appropriate extension folder
file for support for under AppleTalk Remote Access (ARA). He has tried
contacting the company via fax (doesn't go through). I tried contacting
them at [email protected] and there is no such address. Is
the Dove dead? Would anyone outthere have the ARA file for Dove's modems?
Thanks in advance. [email protected]

------------------------------

Date: Wed, 15 Jun 1994 14:29:25 -0400 (EDT)
From: ADAMS KATHERINE
Subject: Electromagnetic fields (EMF)

I just read an article about Honeywell 101 EMX keyboard that supposedly
cancels out the EMF produced by the monitors Has anyone heard about this ?
First are EMF a real problem ? And is that keyboard THE solution ?
Thanks.
Laurent Imbault

------------------------------

Date: Fri, 17 Jun 1994 08:49:57 CDT
From: "Tom Kirke (312) 413-5539"
Subject: Email for Metrowerks

> Does anyone has the internet e-mail address of Metrowerks?

It's APPLELINK:METROWERKS or [email protected].

Tom

------------------------------

Date: Fri, 17 Jun 94 14:42:25 +0200
From: [email protected] (Rolf Kocherhans)
Subject: FileMaker Help

I wold like to extract letter from a word like this:
I have this: "ggaatctagatcgatgctttt" in a FileMaker field and would like to
know who many g, a, t, and c, are contained.
Does anybody have a solution.
I tried it with Position(....,...,...) but it only gives me the first pos
of a letter.

Rolf [email protected]

------------------------------

Date: Fri, 17 Jun 1994 22:26:43 -0400 (EDT)
From: ADAMS KATHERINE
Subject: floating point co-processor

I have recently moved from a power book to an LC 475 and when quitting
exel 4.0 I now get the following message: "sorry a system error occured
'excel' floating point co-processor not installed" !!!????? Even though
it tells me that, everything seems to work just fine so what is that
floating point thing?
Thanks all
Laurent Imbault

p.s.: I have the Software FPU installed and running on my system. (if
that is of any consequence!!??)

------------------------------

Date: Fri, 17 Jun 94 10:28:31 PDT
From: George Steinitz
Subject: Follow up on Quadra 605 power supply

Thanks to all who sent suggestions and other assistance. Since my original
posting I heard back from Steve at SOS-APPL who said they only warranted
that the Mac would run on a standard power supply, so tough luck.

With a scope borrowed from an INFO-MAC cohort I determined that my Trace 612
inverter actually produces a square wave instead of the advertised "modified
sine wave." The guy at Trace was somewhat defensive in insisting that this
square wave was actually a modified sine wave, and could offer no help.

I looked into using a line conditioner but the technician at the supplier
told me not to bother because there was NO WAY it was going to condition a
square wave into a sine wave. So that leaves me with two options yet to be
pursued: Replace the power supply module in the Quadra with an older type
(more expensive?) which will work on square wave, or purchase an inverter
for about $400 which produces sine wave. In the meantime I have been running
my generator whenever I needed to power up the Mac. Oh well, it could be
worse.

Has anyone with a UPS unit and a newer (since last fall) MAC tested whether
it will work? That was one of the original findings - that this problem
first appeared around Sept 93, and that a lot of the UPS hardware will
probably also NOT work for the same reasons.

------------------------------

Date: Fri, 17 Jun 1994 21:53:46 GMT
From: [email protected] (Anders Aspaas)
Subject: FTP-sites for graphics

Is there any anonymous ftp-site which contains clip-arts, illustrations and
so on in mac-format?

---Anders Aspaas E-mail [email protected]
---Students department
---University of Tromso UNIVERSITY OF TROMSO
---N-9037 Tromso THE NORTHERNMOST UNIVERSITY IN THE WORLD
---NORWAY

------------------------------

Date: Fri, 17 Jun 94 13:48:35 EDT
From: [email protected] (William Edwards)
Subject: Getting MacPPP to work with a Supra FAXModem 144LC

Subject says all. I have gotten it to dial into the supposed PPP
dialup. When that picks up, though, it spews out garbage (x's and ~'s)
and then drops me. I am using the following modem init string:

AT&F0&K0S37=9N

which (I believe) disables all compression, and data checking (&F0),
all flow control (&K0), and forces the baud rate to 9600 (S37=9 and
N). Has anybody gotten this modem to work with PPP? This is on a
Classic II 10/40, with System 7.1, and *lots* of inits. Please
respond by email, and I will summarize with the solution. Thanks!
-- Bill Edwards
Dana Farber Cancer Institute/ECOG
303 Boylston Street; Brookline MA 02146
(617) 632-2975; [email protected]; [email protected]

------------------------------

Date: Fri, 17 Jun 1994 10:58:57 -0700 (PDT)
From: Scott Wyant
Subject: Help with Mosiac and Express Modem Tool

Hello all --

Subject says it all. Has anyone been successbul in configuring an Apple
Express Modem to run Mosaic? The rub for me is that I first dial-up a
connection, which is a router, then telnet to my provider. Am I howling
at the moon here, or is it possible? If you'd like, reply to me directly
and I'll summarize. Thank you.

Scott Wyant
[email protected]

------------------------------

Date: Fri, 17 Jun 1994 07:31:14 -0400
From: [email protected]
Subject: HP Thinkjet

Is it possible to use an HP Thinkjet model 2225D+ with my Mac?

This is the serial version.
Do I just need the appropriate driver software?

Thanks

Joe Carson
Princeton University
Plasma Physics Laboratory

[email protected]

------------------------------

Date: Fri, 17 Jun 1994 17:09:30 +0100
From: [email protected] (Tito Valla)
Subject: Ink-jet printer: which one to buy? (Q)

Hi everybody,
I am a student and I would like to buy a inkjet printer for my small
Maacintosh Classic. Resellers from Apple say StyleWriter II is ok and thea
it works well.
Can anyone of you tell me something about his experience with a StyleWriter
II?
Some questions:

- Is it fast?
- What about gray-printing?
- Is it strong enough (I mean the case)
- How much ink do I need?
And finally does anyone of you know if Apple is up to sell a new ink-jet
printer? I wouldn't like to buy StileWriter II and find two days later that
a new printer is sold for half the price.
THANKS FOR YOUR ANSWERS
My address for personal replies:
[email protected]
MASSIMO VALLA :-)

------------------------------

Date: Fri, 17 Jun 94 13:31:16 +0200
From: [email protected] (Karl Pottie)
Subject: Installer Pro 1.0 & Netdistributor 2.0

Has anybody heard of the new Symantec products "Installer Pro 1.0" and
"Netdistributor 2.0" ? These products should allow a network admin to
distribute new software on the network automatically. If you have any
experience with these, please let us know.

Does anybody know if a demo version of these products is available on the
internet ?

------------------------------

Date: Fri, 17 Jun 1994 11:16:17 +0100
From: [email protected] (Adalbert Duda)
Subject: Japanese system Software (A)

Hello,

Yutaka Kawasaki asked a question on using
Japanese software on a Mac.

There is a information guide on Sumex (and it's mirrors) in the info
subdirectory "Using-japanese-on-your-mac" (360 K).

Greetings,
Adalbert
Adalbert Wojciech Duda * Email: [email protected] That's it !

------------------------------

Date: Fri, 17 Jun 1994 12:08:05 CST
From: [email protected]
Subject: Labels Control Panel (Q)

MacColleagues:

Is there a way to increase the number of labels abailable in the
Label menu in the finder? After wondering why this facility
was avalable for a long time, I got a color monitor and have
found it to be very useful. So useful, in fact, that I would
like to have more labels available. Is there a hack I might perform
to extend this menu to include more labels?

Please do not respond by telling me to get better organized. I've been
trying for years and it isn't getting much better. :-)

Thanks

Dave Griffey

------------------------------

Date: Fri, 17 Jun 1994 15:42:02 -0400 (EDT)
From: Seth Ness
Subject: large scale backup solution

hi,
my department would like to set up an automatic backup system for all our
computers over our campus ethernet. In total we probably have several
gigabytes of hard drive to be backed up. From what i know already we
should probably go with retrospect remote and DAT. I'd like to be able to
run the system from a IIci. Is this a good solution? How much will it cost?

also, can drives from MS-DOS machines be backed up this way? what about
Sun workstations?

thanks.


--

Seth L. Ness Ness Gadol Hayah Sham
[email protected]

------------------------------

Date: Fri, 17 Jun 1994 08:01:59 -0500 (EST)
From: Bob Beason
Subject: LaserWriter 8.1.2

I downloaded the new LaserWriter 8f (a.k.a. 8.1.2) and found that it has the
same problem as 8.1 and 8.1.1. It doesn't print landscape mode correctly on
legal paper. Does anyone know of a fix?
Thanks,
Bob Beason

------------------------------

Date: 15 Jun 1994 23:10:16 U
From: "Harris Tom"
Subject: LC III HD Help needed

I updated my LC III/System 7.1 with the SU 3.0 disks. I also updated my Hard
disk driver with the Hard Disk Setup encluded with SU 3.0. I can nolonger
mount or boot from my hard disk. After booting from a floppy and thing that
touches the HD causes the system to hang/freeze.

Is there any way to reinstall the original driver? Any other suggestions are
welcome.

Please email me at [email protected]

------------------------------

Date: Thu, 16 Jun 1994 15:44:46 -0400 (EDT)
From: Sean Gallavan
Subject: LC III HD Help needed

> I updated my LC III/System 7.1 with the SU 3.0 disks. I also updated my
Hard > disk driver with the Hard Disk Setup encluded with SU 3.0. I can
nolonger > mount or boot from my hard disk. After booting from a floppy
and thing that > touches the HD causes the system to hang/freeze. > > Is
there any way to reinstall the original driver? Any other suggestions are
> welcome. > > Please email me at [email protected]

My first instinct is to rebuild the desktop entirely. This means using
ResEdit to make the files visible and then trash them from the hard drive.
There are also a number of uitilies which do this (my favorite is
TechTool). If this doesn't work, try zapping the PRAM by holding down
command-option-P-R as the computer starts. If this doesn't work, then try
doing a complete PRAM zap using a utiity like TechTool.

Hope this helps,

--Sean Gallavan

------------------------------

Date: Thu, 16 Jun 1994 11:25:46 BST
From: Sarah Barnes
Subject: Mac applications on a Novell 3.11 server

Here at the University of Plymouth we are running a number of Mac
applications (approx. 18) on a PC Novell 3.11 server running the Mac
NLM. The applications include:- Word, SPSS, PageMaker, Pegasus
Mail, Excel etc.

All the applications work when run from an LC, IIsi, IIci etc. The
problem arises when an LC 475, Centris or any machine with a Cache
switch tries to run any of the applications with the Cache on. A number
of the applications either crash the machine, give various errors e.g.
"Application unknown has unexpectedly quit, because an error type 3
has occurred", or the application complains that "Floating point
coprocessor is not installed" and the machine Restarts.

If the Cache is off all the applications run from the server. If the Cache
is on and all the applications are copied to the hard disk and run from
there they all work fine.

We have installed the system 7.1 update 2.0 and tried running software
FPU with no luck.

The applications that are causing the problem are:- FileMaker 2.0,
Minitab 8.1, SPSS 4.0, Pegasus 2.0 release 5, WordPerfect 2.1,
PageMaker, Apple File Exchange, Sam Virus Clinic, Hypercard and
Disinfectant.

If anyone has encountered this and has any solutions I would be very
grateful.

We are also upgrading to PageMaker 5.0. This will not work on a
network unless you run concurrency software like Key Server on the
server. This is 415 pounds for a 10 user license. At Plymouth we
would need
a pack for each server running Mac applications which totals 6. Does
anyone know of any other ways of getting PageMaker 5.0 to run on a
network?

Could you please reply directly as I not yet a member of the list.



Sarah Barnes
Computing Service
University of Plymouth
Plymouth
DEVON
(0752) 233916

[email protected]

------------------------------

Date: Fri, 17 Jun 1994 09:10:01 -0400 (EDT)
From: [email protected]
Subject: Macintosh Application Environment (MAE)

I was wondering whether anyone out there had installed and evaluated
Apple's Macintosh Application Environment (MAE) for Unix workstations
yet. We'd like to consider MAE as an alternative to Liken, but seem
to be having lots of trouble getting anyone from Apple to care. I'd
appreciate hearing from anyone who has any impressions of the speed
and robustness of MAE's emulation, or comments about the product in
general. Please e-mail me directly and I'll post a summary to the
Net. Thanks!

Eric Davies
[email protected]

------------------------------

Date: Fri, 17 Jun 1994 09:49:19 -0700 (PDT)
From: Vasant Jayasankar
Subject: Mac LC CMOS Battery Help

I read a letter to Info-Mac some time ago about replacing the
CMOS battery on an LC (including a Radio Shack part #). I thought I
saved it, but I can't find it now that I need it! Anyone out there
have this info, as well as any instructions on how to go about actually
doing the replacement?

Much thanks! E-mail please.


---------------------------------------------------------------------------
Vasant Jayasankar
[email protected]

------------------------------

Date: Thu, 16 Jun 1994 12:49:45 -0700
From: [email protected] (Jason Snell)
Subject: MacUser Magazine on-line letters (gulp)

I'm sure this will result in a flood of letters, but that's sort of the
idea... :)

Announcing: the Internet address for letters to the editor of MacUser --
the appropriately named:

[email protected]

If you have comments about MacUser magazine or the state of the Mac in
general that you'd like to have considered for inclusion in MacUser, send
'em to that address. (We're also still reachable at
[email protected], of course.)

However, I'd discourage you from sending:

1. Requests for specific product-buying advice (the editors currently don't
have the resources to do anything beyond working on material for the
magazine)

2. Requests to look up back issues (see #1)

3. Requests for information about subscriptions -- the subscription
department at MacUser is not currently on-line. International readers can
reach our subscription department by dialing 303-447-9330 (voice line, open
24 hours a day) or 303-443-5080 (Fax line). U.S. (and Canada?) subscribers
can reach us by dialing 800-627-2247.

If you're submitting a letter, please include your full name and a daytime
phone number where you can be reached. Also please indicate if it's
acceptable for us to include your e-mail address with your letter if it's
printed.

All letters become the property of MacUser, and we reserve the right to
edit any letters we print.

If you have any questions, please feel free to e-mail me. Be sure to send
all your mail to [email protected], not my personal address.

Thanks for your time!

-Jason Snell, Assistant Editor, MacUser / Editor, InterText
[email protected]

------------------------------

Date: Fri, 17 Jun 1994 11:19:43 -0500
From: [email protected] (Vinko Tsui (312) 329-3455)
Subject: Metrowers e-mail address [R]

Bueno,


>


Their EMail address is:

[email protected]

-- Vinko


Vinko Enterprises, Oakville, Ontario, Canada, [email protected]

------------------------------

Date: Wed, 15 Jun 1994 22:49:48 -0400 (EDT)
From: Tim Colson
Subject: MIDI on a Mac

Guys, Gals, Other....

I want to know if there is a simple Mac program out there on the ether
that will let me play all of those damnable PC MIDI files ;-)

C'mon now, there MUST be something out there to do it...I mean, we HAVE
sound cards built in..they don't - go figure!

As always - Thanks in advance!

Timothy L. Colson
"[email protected]"
These are my views....nobody else would want them.

------------------------------

Date: Fri, 17 Jun 1994 13:08:55 -0500
From: Larry Rymal
Subject: Monitor Test Pattern Software (R)

On Mon, 13 Jun 1994, [email protected] (Graeme Forbes) wrote:

> A program called Test Pattern Generator by Larry Rymal will do what you
> want. It *may* be in the archives. You can certainly get it on the disk
> that comes with Rymal's book "Macintosh Repair and Upgrade Secrets"
> (Hayden Books) and maybe with other of Rymal's books as well.

Hey! Not yet! Not yet! My book on how to convert a Mac 128 to a
Cray 32E+36 SuperBrain_for_Dweebs_Computer that attacks computer-sales-
things is due out this Fall, but I am NOT the author and creator of the
excellent utility and books being mentioned.
Actually, I'm the `other' Larry. Larry Pina is the one being
referenced to and my only regret is that I am not the one with the
brain-power that he has. His Test Pattern Generator (circa 1988) is
rather dated by now, but still excellent for setting up monitors and
checking linearity, 72dpi measurements, and focus.
His postal address is:

Larry Pina
47 Meadow Road.
Westport, MA 02790

I guess this means I have to get rid of all those royalty checks, now!

--LARRY Rymal

------------------------------

Date: Thu, 16 Jun 94 15:16:05 +0200
From: [email protected] (Karl Pottie)
Subject: Network fax server.

We're looking for a network fax server for sending faxes only. The fax
server should be able to handle *both* Macintosh and Unix Clients. Has
anybody heard of such a beast ?

Karl Pottie
U.Z. Leuven

------------------------------

Date: Thu, 16 Jun 1994 09:47:04 +0100
From: [email protected] (Scott Stricker)
Subject: news readers

What Internet news readers are available for the mac, and does
anyone out there have any preferences as to which one is best?
So far, I've looked at Nuntius and InterNews.

Thanks in advance for your responses.

Thanks

------------

Scott - [email protected]

------------------------------

Date: 17 Jun 1994 14:46:51 +0000
From: [email protected] (Alan Hewat, ILL Grenoble)
Subject: PowerMac Compilers (A)

[email protected] (Gary L. Gray) wrote on 7 June:
>I am waiting on Language Systems native FORTRAN compiler. I have used their
>compiler for years and have been very pleased with its stability, compile
>times, and generation of fast code. They expect to release it in August. I
>also know that Absoft has a native version of their FORTRAN compiler, but I
>have never been happy with the stability of Absoft's compilers.

I understand (from a LS posting to comp.lang.fortran) that the 'August' release
of the LS Fortran compiler will be at best an alpha release, while Absoft have
already released theirs. There is no justification for the shot at the
'stability'
of the Absoft product. Absoft make a number of very professional compilers.
In fact the Absoft Fortran compiler for 68K Macs was generally faster than
that of LS (which is also a solid product). There were reviews by Jorg
Langowski
in MacTutor/MacTech.

If you already have LS, you can probably wait (since the professional versions
are about $750), but if you have neither, you may as well buy Absoft now.

Alan Hewat, ILL Grenoble, FRANCE ([email protected]) Fax (France=33).76.48.39.06

------------------------------

Date: Fri, 17 Jun 1994 09:48:08 -0800
From: [email protected] (Dieder Bylsma)
Subject: PPC ugprade card and internal video cards

>I've been thinking of buying Apple's $700 PowerMac Upgrade Card for my
>Quadra 700. Researching the card, I came across a throwaway remark in a
>review, saying that the card doesn't support two monitors. Does this, by
>any chance, mean that the card doesn't support two monitors? I have an
>Apple Portrait Display running off the Q700's internal video and a Nec 3FG
>running off a video board in a NB slot. Can it really be true that if I
>boot up with the 601 enabled, I lose one of the monitors?


It ain't so! All it means is that the PPC card does not have a video-out
port on it, that's all. Actually, it doesn't have any ports coming out of
it, you just plug it in to the PDS slot, and voila, it takes over your
computer's parts when you tell it to do so. Nothing stopping you from using
your NuBus cards. The only time in which the PPC upgrade card prevents a
user from using two monitors is in the case of single-expansion slot
computers like the Quadra and Centris 610s, since it plugs in the only
available slot for that type of expansion.

Hope this helps,

Dieder


--
___ ___
Dieder Bylsma
( v ) [email protected] ( v )
-----"-"-------------------------------------"-"-

------------------------------

Date: Thu, 16 Jun 1994 07:59:51 -0800
From: [email protected] (Kim Cary)
Subject: Printscreen from tn3270 2.4d9 to DeskWriter

File menu, Print Screen... from tn3270 2.4d9 produces an unreadable printout.
This comes out with symbol characters (not the same trash as printscreen
with laserwriter-color/grayscale option). Anyone got a line on what to do?
Please email mail, and I'll post a summary.

I've been trying to track this package down at an FTP site somewhere, btw.
Anyone know where it or its successor is (archie never works for me)?


Kim Cary-Instructional Technologist-Grad School of Ed & Psy
Pepperdine University([email protected])310-568-5628
"Boredom excites me!"

------------------------------

Date: Wed, 15 Jun 94 18:29:13 EDT
From: "Allan M. Bloom"
Subject: ProDOS Extension Revisited

My thanks to Jeff Fritz (despite my trashing of his beloved 'eers and
West Virginia University in general) and to Murph Sewall re my comments
earlier this week about Apple's ProDOS extension killing both TN3270 and
BeHierarchic. Buried within Jeff's counter assault on the Good Guys at
Virginia Tech was a note that TN3270 and ProDOS coexisted nicely on his
machine. Murph suggested buggering ProDOS's load order, an idea I might
have come up with myself if I hadn't been brain burned. Not only is old
age heck, my masters have seen fit to neither air condition my office nor
properly insulate the heat pipes running under my floor. Add that to my
office catching the afternoon sun and the recent heat wave, and I have
all the excuse I need to be stupid.

To shorten an already too long tale, I moved ProDOS from its nominal
place in Extensions to the root of the System Folder. Voila! No problem,
mon. Either on the office Q650 with direct connection, or on the home
IIci with SLIP access, to the internet. Both TN3270 and BeHierarchic
do their things. I haven't had time to notice if anything else dies.

Stay tuned. Film at eleven.

Al Bloom, Virginia Tech

------------------------------

Date: Thu, 16 Jun 94 09:35:58 EDT
From: [email protected]
Subject: QuickDex: I need info

I have seen and used a little program called QuickDex, by (I think) Greene
Inc.
It's a great little program; there are NO frills, but it's pretty much
instant access to your phone numbers and addresses. Problem is, I want to
order a copy, and can't find the company. The phone numbers I have
go to the wrong companies now (and the secretaries sounded quite irritated).
Can anyone direct me to the source for this program?

Thanks In Advance.

Brandon Munday
[email protected]

------------------------------

Date: Thu, 16 Jun 94 14:51:06 EDT
From: [email protected]
Subject: QuickDex: I need info

[email protected] on Jun 16 09:32 1994 EDT wrote:

>I have seen and used a little program called QuickDex, by (I think)
>Greene Inc. It's a great little program; there are NO frills, but it's
>pretty much instant access to your phone numbers and addresses. Problem
>is, I want to order a copy, and can't find the company phone numbers

According to my latest (received today) Computer Select CD-ROM,
Casady & Greene, Inc, 22734 Portola Dr, Salinas, CA 93908-9228 makes
QuickDEX II. Phone numbers are: 800-359-4920; 408-484-9228;
FAX: 408-484-9218. Falls into the Category of Software Applications
(Personal Information Managers (PIMs)).

jd

------------------------------

Date: Wed, 15 Jun 1994 12:00:47 -0700 (PDT)
From: John Thoo
Subject: Record Button extension (R)

Last time I asked what the "Record Button" extension SU3.0 put in my
System Folder was for. Several very kind folks responded (thanks, y'all
:-) telling me that the extension is for use with the record button on
an Apple adjustable keyboard. (The adjustable keyboard, apparently, has
a record button that activates a built-in microphone ... did I get that
right?) Anyhow, it's probably safe to trash the Record Button extension
if you don't have an adjustable keyboard.

--John.
J. B. THOO, Math Dept, Univ of California, Davis, CA 95616-8633
Internet: or

------------------------------

Date: Wed, 15 Jun 94 18:10:46 EDT
From: [email protected]
Subject: Samna Word 4 files - converting to Mac

Hi,
I'm not on the info-mac distribution list, so please e-mail
replies to both the list and me. ([email protected])

We have a large amount of files stored on a vintage PC-AT
in the Samna Word 4 format. We'd like to get a Mac,
but need a way to translate the files to a Mac word processor.
Does anyone know of a program that can read in Samna files,
translating them footnotes and formatting intact?
Our getting a Mac depends on our ability to translate the files,
so please let us know.

Thanks in advance,
Michael E.
[email protected]

------------------------------

Date: Wed, 15 Jun 1994 14:23:56 -0400 (EDT)
From: ADAMS KATHERINE
Subject: screen freezes

When I play certain ball games (brick bash for instance) my screen
unexpectedly freezes and I have to click the mouse to see it
re-activates. Why ?
I have an LC 475 with the 32 bit addr. on.
Thanks
Laurent Imbault

------------------------------

Date: Fri, 17 Jun 1994 15:30 EST
From: "Don't Panic!"
Subject: SCSI to 386/486 platform hard disk conversion (Q)

Dear Netters,
Sorry if this is FAQ. Is there a method to convert a SCSI-2, or SCSI-1
external
hard drive to an external MS-DOS hard drive?
How much does this usually cost once you have a SCSI hard disk? Is there a
method of doing the opposite - i.e. converting a Dos platform hard drive to a
Macintosh formatted hard drive?
I have not yet gotten a new hard disk.
Thank you.
Sincerely,
[email protected]

------------------------------

Date: Fri, 17 Jun 1994 09:15:20 -0500 (CDT)
From: Steven Michael Fish
Subject: Sound Archives

I am looking for some high quality sound samples on the Internet. Is
anyone aware of an FTP site with such an archive? My preference is for
short 44k 16bit (i.e. CDAudio quality) samples if they are available.

Thanks in advance. . .

Steven M. Fish ([email protected])

------------------------------

Date: 17 Jun 1994 15:18:22 +0000
From: [email protected] (Alan Hewat, ILL Grenoble)
Subject: Speed of PowerMac native Fortran compared to SGI and HP Unix

The new Absoft native PowerMac fortran compiler produces code rated
at 13 Mflops on the Mac PowerPC, which is much the same as the entry
level Silicon Graphics IndyPC or HP 712/60. The price of these machines
is also comparable (about $5K). With its very Mac-like interface and
superb 3D graphics utilities (openGL, Inventor, Explorer) the SGI machine
is much more competitive for scientists and engineers than Brian Bezanson
(and Adam Engst) would have us believe in a recent TidBits article.

13 Mflops is however quite impressive compared to 1.6 Mflops on my old
Quadra 700 ;-)

Alan Hewat, ILL Grenoble, FRANCE ([email protected]) Fax (France=33).76.48.39.06

------------------------------

Date: Thu, 16 Jun 1994 12:23:13 -0400 (EDT)
From: [email protected]
Subject: Syquest substitutes any good?

/////Begin included message:
Date: Tue, 07 Jun 94 13:07:29 PDT
From: Paul Brians
Subject: Syquest substitutes any good?

Syquest is vehement in stating that only Syquest-brand cartridges should
be used--but then they would, wouldn't they? Anybody have experience
with the imitators? The price is right.

Paul Brians, Washington State University, Pullman, WA 99164-5020
\\\\\End included message.

Paul-
For what it's worth, if you bought your SyQuest drive in the last few
months, then you might not be able to use any cartridge but a SyQuest cart.
According to rumors I've heard on the net (and personal experience) SyQuest
futzed with the ROM's so that if the cart wasn't a SyQ cart, it wouldn't work.
I have an associate who tried to use PLI carts with his new 44mb drive
and it wouldn't let the computer startup. When he called the mail-order place
he bought everything from (the drive and the carts), the tech support guy said
something about SyQ doing this to prevent Bernoulli's carts from being used,
and thus every third party's carts.
I myself have a 2 year old mechanism and am using a SyQuest cart as
well as a Focus cart. But my mech was made before this whole Bernoulli/SyQuest
War started.

Good luck!!!

Adam Gerstein
[email protected]

------------------------------

Date: Fri, 17 Jun 1994 08:09:40 -0500 (EST)
From: Bob Beason
Subject: System 7.1 emergency dis

Try running Norton's on the disk. I expect that the boot blocks were not
created as a boot disk. Norton's will ask if you want to do this. You
should then be able to boot.
.Bob

------------------------------

Date: Fri, 17 Jun 1994 14:54:57 -0500
From: [email protected] (Vinko Tsui (312) 329-3455)
Subject: System 7.1 emergency disc [R]

John,

>

I don't think you need to rename Norton Utilties to "Finder". Normally when
the Mac cannot find the Finder on the Startup volume where the "System"
file is, it will start whatever application it can find at the same
location.

-- Vinko

Vinko Enterprises, Oakville, Ontario, Canada, [email protected]

------------------------------

Date: Fri, 17 Jun 1994 09:54:39 -0600
From: Earl Misanchuk
Subject: TeachText/SimpleText Scrolling [Q]

Can anyone explain why the various versions of TeachText, and now SimpleText,
refuse to advance (or reverse) exactly one page when the scroll bars are
clicked? I cannot recall another application in which this happens, but TT
consistently advances one pageful plus one line, necessitating a mouse trip
back
to the scrolling arrows in order to continue reading the text.

Is there any way around this "feature"?

------------------------------

Date: Tue, 14 Jun 94 14:11 BST-1
From: Pindar Infotek Ltd
Subject: US PowerMac pricing

>From Pindar user Ian McCall

Subject: _US PowerMac pricing
Can anyone give me an idea of how much a PowerMac 6100AV 16/250 CD
with SoftWindows might cost in the US? CPU only - no monitor or
keyboard.

Additionally, up to what size of monitor would that support?



---
Please make 'Attn:Ian McCall' the first line of your reply
(not the subject) to ensure automatic forwarding to the correct
Pindar user.

------------------------------

Date: Fri, 17 Jun 1994 11:37:07 -0400
From: "Tom Scott"
Subject: Veronica and Al

Veronica and Al
Huh? Not Veronica and Archie? Let me explain...

I have two areas of questions I want to ask your expertise on.
The first area deals with Veronica.

Archie has many ways of performing a search; via telnet, through
gopher, via e-mail, and two standalone products known as Archie 1.0
and Anarchie. I like the flexibility this offers.

Veronica Question #1) As far as I know, you can only access VERONICA
servers via Gopher. Isn't there any other alternative ways of doing a
Veronica search? Why isn't there a telnet site veronica.internic.net
to parallel archie.internic.net? Are ther any standalone Veronica apps?

Veronica Question #2) ooo Differences between NYSERNET, PSINet, others
as far as Veronica sites??? Difference between seaarch for file vs search for
name?


Now the Al I refer to is our esteemed VP, Al Gore. He gave a speech
(probably several) making reference to the "information superhighway".
I would like to find the path to the transcript of (hopefully) his
first speech making this reference. Can anyone point me to a gopher
site that might have this?

Please respond ASAP. TIA!

Cheers!

Tom

===========================================================
Thomas Scott, Systems Manager, College of Engineering
Cornell University, Carpenter Hall Annex, Ithaca, NY 14853
===========================================================

------------------------------

Date: Fri, 17 Jun 1994 12:41:22 -0400
From: "Tom Scott"
Subject: Veronica and Al

Veronica and Al
Oops, I sent this out before I checked something out. I wrote these questions
on my PowerBook on my way to work, and I couldn't remember the exact format of
the Veronica level in Gopher. When I asked:

Veronica Question #2) Differences between NYSERNET, PSINet, others as
far as Veronica sites??? Difference between seaarch for file vs search
for name?

I wanted to ask:

Veronica Question #2) What are the differences between NYSERNET,
PSINet, others as far as Veronica sites??? What is the difference
between the "Find ONLY DIRECTORIES by Title Word(s)" query and the
"Search GopherSpace by Title Word(s)" query?

Thanks again.

Please respond ASAP. TIA!

Cheers!

Tom

===========================================================
Thomas Scott, Systems Manager, College of Engineering
Cornell University, Carpenter Hall Annex, Ithaca, NY 14853
===========================================================

------------------------------

Date: Fri, 17 Jun 1994 15:44:49 -0400
From: [email protected] (P. Tucker Withington)
Subject: Why I would buy commercial Eudora

If you told me that in the commercial version of Eudora, it _always_
scrolled in "page increments", I would buy it. The most annoying flaw in
the free version is that in a multi-page message, all the pages scroll the
same, except the last partial page, which only scrolls enough to get on the
page. As a result, I spend several seconds trying to figure out where my
eye left off reading. My guess is that there is probably extra work done
to scroll funny in the last page. My suggestion is: *it just ain't worth
it*!

------------------------------

Date: 13 Jun 1994 14:24:02 -0600
From: Gibbs-T-MMC-BM
Subject: X-windows emulator

White Pine Software, 603-886-9050, makes Exodus for the Mac. It works well for
us and we've had good support from them so far. Apple makes a competing
product, MacX. I've also heard of Echo X from Alisa Systems, 818-792-9474.

tgibbs

------------------------------

End of Info-Mac Digest
******************************